This thesis focuses on charge transport in semiconductor InSb nanowire quantum devices, including the electron transport, the hole transport, and the Cooper pair transport. Devices in which InSb semiconductor nanowire quantum dots are coupled with normal metals, superconductors or the proximity effect induced topological superconductors are fabricated and measured. Firstly, we have fabricated and

Nuclear magnetic resonance (NMR) diffusometry provides important information about molecular motion on a microscopic scale. The advantage of NMR diffusometry is its ability to characterise microstructures non-invasively. This has made the method important not only in chemistry, biochemistry and materials science, but also in medicine. Diffusion-weighted magnetic resonance imaging (DW-MRI) has been

Popular Abstract in English ...GTAAAAATTAAGCACAGTGGAAGAATTTCATTCTGTTCTCAGTTTTCCTGGAT TATGCCTGGCACCATTAAAGAAAATATCTTTGGTGTTTCCTATGATGAATATAGATACA GAAGCGTCATCAAAGCATGCCAACTAGAAGAG1.... The string of these block letters (A, T, C and G) is a tiny part of the human DNA sequence, which is more than 3 billion letters long. The combination of these block letters carries genetic information, similar to howThe importance of nucleic acids in pure form for preparative and analytical perspectives, have increased constantly, demanding the development of new and more efficient methods for their recovery and isolation. This thesis describes a series of different innovative methods for recovery and purification of these biomolecules. In a general overview of a downstream processing, there are several criti

Structured Laser Illumination Planar Imaging (SLIPI) is used in combination with LIF/Mie ratio and two-side Mie imaging (dual-SLIPI) for a two-dimensional mapping of both the droplet Sauter Mean Diameter (SMD) and the extinction coefficient ( ). By means of combining the two techniques simultaneously, the local distribution of droplet concentration as well as the liquid volume fraction can also be

to be added

In this paper, I discuss the significance of anti-Catholicism in the construction of Scandinavian identity in the first part of the 20th century, which expressions it took and how it changed over time. Crucial here is the relationship between the existence of a common body of European ideas and developments specific to the Nordic countries. I will show that anti-Catholicism played an important rol

In this study, the problem of feature extraction by scale-space methods is addressed. The modeling of image acquisition, image interporation and scale-space smoothing is discussed, with particular emphasis on the influence of random errors and the interplay between the discrete and continuous representations. In doing so, new results are given on the stochastic properties of discrete and continuou