Filetype
The uprisings in the Middle East in 2011 had repercussions in Morocco too, where demonstrators demanded a reform of the political system. The king managed to diffuse the protests by presenting a new constitution which was accepted by 98,5 percent of the voters in a referendum in July 2011. While the new constitution introduces some limited restrictions on the king’s power, the bulk of executive po
Paper 1: Convergent validity of K‐SADS‐PL by comparison with MASC and TRF in a Norwegian clinical sample by M. Villabø and colleagues; Paper 2: Exploring the effectiveness of working memory training in reducing anxiety and improving educational achievement in young people by H. J. Richards and colleagues; Paper 3: OCD in children and adolescents: Effect of treatment and predictors for the results
In the graph motif problem, we are given as input a vertex-colored graph H (the host graph) and a multiset of colors M (the motif). Our task is to decide whether H has a connected set of vertices whose multiset of colors agrees with M. The graph motif problem is NP-complete but known to admit parameterized algorithms that run in linear time in the size of H. We demonstrate that algorithms based on
Detta projekt uppmärksammar brottsoffer och etnicitetsfrågor. I fokus står mellanmänskliga tolkningar av etnicitetens betydelse. Syftet är att analysera etnicitetstillskrivningar hos ungdomar som blivit utsatta för rån eller misshandel av andra ungdomar ”med annan etnicitet”. Med samtalsintervjun som metod studeras hur etnicitet omtalas och behandlas. Innebörden av begreppet är inte entydig, det i
Popular Abstract in English ...GTAAAAATTAAGCACAGTGGAAGAATTTCATTCTGTTCTCAGTTTTCCTGGAT TATGCCTGGCACCATTAAAGAAAATATCTTTGGTGTTTCCTATGATGAATATAGATACA GAAGCGTCATCAAAGCATGCCAACTAGAAGAG1.... The string of these block letters (A, T, C and G) is a tiny part of the human DNA sequence, which is more than 3 billion letters long. The combination of these block letters carries genetic information, similar to howThe importance of nucleic acids in pure form for preparative and analytical perspectives, have increased constantly, demanding the development of new and more efficient methods for their recovery and isolation. This thesis describes a series of different innovative methods for recovery and purification of these biomolecules. In a general overview of a downstream processing, there are several criti
