Sökresultat

Filtyp

Din sökning på "*" gav 381271 sökträffar

Recent advances in CBT treatments (Chair)

Paper 1: Convergent validity of K‐SADS‐PL by comparison with MASC and TRF in a Norwegian clinical sample by M. Villabø and colleagues; Paper 2: Exploring the effectiveness of working memory training in reducing anxiety and improving educational achievement in young people by H. J. Richards and colleagues; Paper 3: OCD in children and adolescents: Effect of treatment and predictors for the results

Engineering Motif Search for Large Graphs

In the graph motif problem, we are given as input a vertex-colored graph H (the host graph) and a multiset of colors M (the motif). Our task is to decide whether H has a connected set of vertices whose multiset of colors agrees with M. The graph motif problem is NP-complete but known to admit parameterized algorithms that run in linear time in the size of H. We demonstrate that algorithms based on

Betydelsen av etnicitet: gestaltningar av ’de andra’ i samtal om otrygghet, kriminalitet och utsatthet för brott

Detta projekt uppmärksammar brottsoffer och etnicitetsfrågor. I fokus står mellanmänskliga tolkningar av etnicitetens betydelse. Syftet är att analysera etnicitetstillskrivningar hos ungdomar som blivit utsatta för rån eller misshandel av andra ungdomar ”med annan etnicitet”. Med samtalsintervjun som metod studeras hur etnicitet omtalas och behandlas. Innebörden av begreppet är inte entydig, det i

Nucleic Acids: Innovative Methods for Recovery, Clarification and Purification

Popular Abstract in English ...GTAAAAATTAAGCACAGTGGAAGAATTTCATTCTGTTCTCAGTTTTCCTGGAT TATGCCTGGCACCATTAAAGAAAATATCTTTGGTGTTTCCTATGATGAATATAGATACA GAAGCGTCATCAAAGCATGCCAACTAGAAGAG1.... The string of these block letters (A, T, C and G) is a tiny part of the human DNA sequence, which is more than 3 billion letters long. The combination of these block letters carries genetic information, similar to howThe importance of nucleic acids in pure form for preparative and analytical perspectives, have increased constantly, demanding the development of new and more efficient methods for their recovery and isolation. This thesis describes a series of different innovative methods for recovery and purification of these biomolecules. In a general overview of a downstream processing, there are several criti

Homogenization of woven materials

The effective electric and magnetic material properties of a complex (twocomponent) mixture are addressed. The mixture is periodic in two directions and has a finite thickness in the third direction. Specifically,the explicit problem of finding the effective electric parameters for slab that has been reinforced by a layer (or several layers) of glass fiber is investigated. The homogenization probl