Popular Abstract in English ...GTAAAAATTAAGCACAGTGGAAGAATTTCATTCTGTTCTCAGTTTTCCTGGAT TATGCCTGGCACCATTAAAGAAAATATCTTTGGTGTTTCCTATGATGAATATAGATACA GAAGCGTCATCAAAGCATGCCAACTAGAAGAG1.... The string of these block letters (A, T, C and G) is a tiny part of the human DNA sequence, which is more than 3 billion letters long. The combination of these block letters carries genetic information, similar to howThe importance of nucleic acids in pure form for preparative and analytical perspectives, have increased constantly, demanding the development of new and more efficient methods for their recovery and isolation. This thesis describes a series of different innovative methods for recovery and purification of these biomolecules. In a general overview of a downstream processing, there are several criti

Abstract is not available

The effective electric and magnetic material properties of a complex (twocomponent) mixture are addressed. The mixture is periodic in two directions and has a finite thickness in the third direction. Specifically,the explicit problem of finding the effective electric parameters for slab that has been reinforced by a layer (or several layers) of glass fiber is investigated. The homogenization probl

This paper presents an efficient numerical method to design PI controllers. The design is based on optimization of the load disturbance rejection, with constraints on the sensitivity and weighting of the set point response. Thus, the formulation of the design problem captures many aspects of industrial control problems. It leads to a nonconvex optimization problem. Efficient ways to solve the prob

Modes of propagation of electromagnetic pulses in open circular waveguides are investigated systematically. Core and cladding both consist of simple (linear, homogeneous, isotropic), dispersive materials modeled by temporal convolution with physically sound susceptibility kernels. Under these circumstances, pulses cannot propagate along the guide unless the sum of the (first) initial derivatives of

The determination of lead in permanent teeth is a useful measure of past exposure in early childhood since these teeth are mineralized in early childhood. Particle-induced X-ray emission (PIXE) analysis has been shown to be a method with good applicability for the contamination-free analysis of elements heavier than calcium in dental hard tissues. The method is rapid and nondestructive. The purpos

To combat interference between users in a DS/CDMA system, several multiuser detection schemes have been proposed. This paper presents a prestudy for a custom DSP implementation of a multi-user detector scheme based on non-decision directed interference cancellation. Two architectural implementation methods for asynchronous detection are suggested and mutually compared. Each of the architectures is

The Internet domains are tied together by service level agreements which are based on various QoS parameters such as delay, jitter, packet-loss rate, throughput and availability. To offer tighter and more comprehensive service level agreements, accurate modeling of IP traffic and its queuing behavior over the entire network domain is necessary. We present a novel analytical model of a single route