Sökresultat
Filtrera
Filtyp
Din sökning på "*" gav 548094 sökträffar
Hemmet bland bergen. Svenska missionsberättelser från bergsstationen Kodaikanal
Gender and Critical Animal Studies : Potentials and Possible Tensions
Enforcement of China's Accounting Standards: Reflections on Systemic Problems
Mechanisms for establishing and changing terms and conditions of employment in Sweden
Communication strategies for cultural institutions: An empirical study of how a Swedish cultural centre manages communication in a liquid society
Recent advances in CBT treatments (Chair)
Paper 1: Convergent validity of K‐SADS‐PL by comparison with MASC and TRF in a Norwegian clinical sample by M. Villabø and colleagues; Paper 2: Exploring the effectiveness of working memory training in reducing anxiety and improving educational achievement in young people by H. J. Richards and colleagues; Paper 3: OCD in children and adolescents: Effect of treatment and predictors for the results
A challenge for professional influence on syllabi in medicine and nursing
Engineering Motif Search for Large Graphs
In the graph motif problem, we are given as input a vertex-colored graph H (the host graph) and a multiset of colors M (the motif). Our task is to decide whether H has a connected set of vertices whose multiset of colors agrees with M. The graph motif problem is NP-complete but known to admit parameterized algorithms that run in linear time in the size of H. We demonstrate that algorithms based on
IMAGE QUALITY OPTIMISATION AND DOSE MANAGEMENT IN CT, SPECT/CT, AND PET/CT
Decomplexing biofluids using microchip based acoustophoresis
Betydelsen av etnicitet: gestaltningar av ’de andra’ i samtal om otrygghet, kriminalitet och utsatthet för brott
Detta projekt uppmärksammar brottsoffer och etnicitetsfrågor. I fokus står mellanmänskliga tolkningar av etnicitetens betydelse. Syftet är att analysera etnicitetstillskrivningar hos ungdomar som blivit utsatta för rån eller misshandel av andra ungdomar ”med annan etnicitet”. Med samtalsintervjun som metod studeras hur etnicitet omtalas och behandlas. Innebörden av begreppet är inte entydig, det i
The annual mean lowest temperature reconstruction based on Pinus Bungeanas (Pinus bungeana Zucc) ring width in the Yulin Region, Shandong, China since AD 1616
Scaling Down Multi-Echelon Inventory Problems
A SVD Based Controller Reduction Method
Nucleic Acids: Innovative Methods for Recovery, Clarification and Purification
Popular Abstract in English ...GTAAAAATTAAGCACAGTGGAAGAATTTCATTCTGTTCTCAGTTTTCCTGGAT TATGCCTGGCACCATTAAAGAAAATATCTTTGGTGTTTCCTATGATGAATATAGATACA GAAGCGTCATCAAAGCATGCCAACTAGAAGAG1.... The string of these block letters (A, T, C and G) is a tiny part of the human DNA sequence, which is more than 3 billion letters long. The combination of these block letters carries genetic information, similar to howThe importance of nucleic acids in pure form for preparative and analytical perspectives, have increased constantly, demanding the development of new and more efficient methods for their recovery and isolation. This thesis describes a series of different innovative methods for recovery and purification of these biomolecules. In a general overview of a downstream processing, there are several criti
Optimal Conditions for Critical Thinking : Between Relativism and Absolutism
2012; underhållning eller ej?
Intentional Partnerships – Creating New Partnerships
Syllabification in Southern Sámi
Abstract is not available
